DNA

Cactus DNA: What Does It Tell US?

(Photograph  = DNA strand)

Introduction

All the cactus species are related, just like all the great ape species (chimpanzee, bonobo, gorilla, gibbon, and human) are related. But, there are differences in their DNA that can tell us how closely related the various cacti are.

The Details

Large differences mean organisms are not too closely related, but even small differences in DNA can mean something. These sequences shows how two different Opuntia species can have small differences in the DNA of a gene.

  1. The first strand (top) is from O. ficus-indica.
  2. The second strand (bottom) is from O. phaecantha
  3. The red DNA letters show where the DNA from the two species is different.
  4. The vertical bars show where the DNA from the two species is identical.
GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCCGCTATCGAAGCTCCG  
|||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| ||
GTTATGCATGAACGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTATTGAAGCTTCG

Maybe there are greater differences in the DNA of other genes, or maybe there are fewer. The information from DNA studies can even tell about cactus evolution–when and where cacti evolved.

Related reading: Epiphytic Cactus Phylogeny

3 thoughts on “Cactus DNA: What Does It Tell US?”

  1. Very Interesting Joe! I’d Love to see this done with the many different “Forms” of O. humifusa on the East Coast. I’m sure someone’s checked DNA on many of them.

  2. Yes, very interesting . Perhaps re the photos : would it be too much to show both species as comparison. I.e. Flower of each species, cladode of each etc ?

Leave a Reply